Genomic Feature

ihb61

ID
ZDB-ALT-151023-1
Name
ihb61
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 3087393 - 3087409 (GRCz11) (1) Details
Nucleotide change
GTGGCTCTGTGCGCCGG/-
Variant Notes
Between 240 bp to 258 bp of the wild-type lhx2b coding sequence,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
17 bp deleted from position 240 to 258 (1)
Transcript Consequence
None
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CACCTCTGATTAATTTACTTAAAAATGCATTGGATTTTACGAAATTCTTATGTTAAAAGTGAAAAAACACGCAAATGGATGCATGCACAATATAATACATTCTATCTGTTGTATCCTCTTTATATGCATGATCCTCCGTTGTCACGGGAAATGTTAAAAAAAATTAAAGTAGCCTATATATCGGCTCTTATTCACTCTAAACTTGTGTATTTATCTTCTGAATTTGTTCTCACGCCCCTCCCATTCTATACACAAGTGAGCACTATTTTACTCTTAGCATGTTTTTTTATACCCAGCAAATGCGTAAAATAGTGTTTACACTCATCCCTAAAGCCATTACCATTATAATTTACAAATCTGCCTTTTAATATCATTGCTGCAACATAAGAGAGAATGGTGGAGAAAAAAAATCTGTGTTTGTGTAAGATTGGGATTTGAGTTCGTGCATTTAATGAGTCTGTGTGTTTCCGCAGAACATGCCTTCAATCAGCGGGGATCGG
GTGGCTCTGTGCGCCGG/- CTGCGGAGGCAAGATTTCGGATCGCTACTACCTGCTCGCCGTGGACAAGCAATGGCACATGCGCTGTCTGAAGTGCTGCGAGTGTAAACTGAACCTGGAGTCTGAGCTCACCTGCTTCAGCAAAGACGGAAGCATCTACTGCAAAGAAGACTATTACAGGTGAGCCAACTCATTTGGCTACGTAAAAAGTTGATTTTAAGTTCATTTTTTCGCATTAGGAGTTTAGTTTTCGTTGTGGATAAATAATAAAAAGACAAAAGTTGTATTTTGTAAAGATATGCATTTGTTTGTAGATATATTAGATCTATTTTCTTACTTCAATTTAACGAAAAACAAAGACGCAACTAATTTCCATTGTGGGCATAACAATAATGTTGTTTTAATGTATTTTTTTTCTATTTAAAATACAAAATAATCAATGTCAATATTTCAGAAAGGATTGATTTTACTAGAATTTGTTGTTTGCTCATAATAATCTTTTATGTTTGTTTAAATTAATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations