ZFIN ID: ZDB-ALT-150120-1
Genomic Feature: psi7
Synonyms:
Affected Genomic Regions: pcdh15a (1)
Type: Point Mutation (1)
Protocol:
Lab Of Origin: Piotrowski Lab
Location: Chr 13: 41367108 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site, Frameshift (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TGCCATCATGTCAATATGGACCAAAATCTCTGAGCAATATTTCTAGTACCTTGTTGAATCTAGGCCACAAAGCATTAAGGCAGTTCTGAAGGCAAAAAGGGGTCCAACCCAGTACTAGTAAGGTGTACATAATAAAGTGGCCAGTGAATGTATATGTACAGTAATTAATAACACAATTGATATATTTTTACTAATCAAGGCAAGGTTACAAAACTAAAATAAATGCAGGAAGTCAAAGTTTTACAACTGCACTATTAAAAGCAATTACAAATATAAAAAAATGTTGAAAAAAAGTTGAAGTCAAAACTATTCGCCTTCCTGCTCTTTTTCAAATTTTTCCTAATTGATGTTTAACAAAGCAAGGATTTTATTTTATTTTTTACAGTATTTCCTATAATACAACACCACAAACAGAAGGCACCTGGAAAACGCTGCTAAATCATTAATCACAATGAAGAAGTTTAGTGTAACTGCAGAAGCTCAGCCTGATCAAATGAAGT
A/C
CCGGGTCATTTGGGTTATACTGAATGGCGTATTCAATCTGTCCGTTTGGTCCGTCGTCAATGTCCGTGGCTCCATTGTTTCCTGAGAAGCCGGTAAAGATAGTGGTGCCAACAGGAGTGAGCTGCAAAAAACAAAAATGATAAATAAAAAAAAACACATGAAACATACATCAGACCCTGGCGATACGCGAGTGTAACAATACAGCGACTCTGACAGTCCTCAGATGTGACCCAGCAGATGGTGTGTGTGTGTGTTTGTGTGTGTTTGTGTGTGTTTGTGCGCGTGTGTGTGTGTGTGTTTCTGTTGTATCAATCGAAGACACAGGGACAGAAGAGGTAGAAAAAAAATACAGAGAAAAGGCGAAACAAAGAGAAGACAACAAAAAAGCGGGAGTCAAAACGGAAAATGAGAGACAGGGAGAAAAACAATCATGTCTGAACATAAATACACTCACTACTGATATTAAAATAACAGGCGGGTCATTCTACAACTGCGGTGGC
Comment Citation
The psi7 allele encodes a splice site mutation in pcdh15a, causing a frameshift  ... Maeda et al., 2014
OTHER psi7 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pcdh15apsi7/psi7 pcdh15a ♀+/- ♂+/-
Complex pcdh15apsi7/psi7; vo23Tg pcdh15a
zf2120Tg ; pcdh15apsi7/psi7 (TU) pcdh15a

CITATIONS  (5)