ZFIN ID: ZDB-ALT-131220-347
Genomic Feature: sa22279
Synonyms:
Affected Genomic Regions: synpo2la (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 22258969 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
TACTCATATCGGTTGTAAAAAAGTGTTATCGGTTCATCCCTACATTATCCCTAAATTAAAATTTCAGCACTAGTAAACAAAGACTTTCCCAATGGTAGACAAATCATTTTTGCATCAAAGTTATATTATTAATTTAACCATGCTTCCTTGTTGCAAAATTCTTTAACTAAAACGCGGTTGCTGTTAAATATTTGTAATATATATATATACTGTCTCAAACCTTTTTATCTTATGTTATGCAGAATTGAACCGTGGAGAGACAATCACAGACAAGCAGGTGAAAGAGGCCCGGTCCAAGTGCCGCACAATCGCCTCACTACTGACAGATGCACCAAACCCTCATTCAAAGGGTGTACTGATGTTTAAAAAGCGCCGGCAACGATCCAAGAAATATACACTGACCAGCTTTGGAAGTGTTGATGAGGACATGAGGCAGGACTCTCAAGAGGAGGATGGCATATTTCCTGGCAGTGAATCAGAATTTGATGAGGAGGGTTTTT
C/A
AGCTGCACCGGACCCCACATGGGACAGCGACTACCTTGAAATGCTGGAGAAAAGATGTGCTTCCAGAGGTCAGGAAGGAGATGGTGGTGCTCTTAGTCCTGGTCTGAGTGATACATCTGGAAAGGGGGCACAGTTGTTTGAGCAGCAGAGGAAAAGGGCTGAAGAGCATGCAAGAAAAATCGAAGCTGCACAAGAACAGTTACAAAGCCAAATGCTGGGCATTTCACTGAAAGAGGCCCAGGCACTTCCTCCGCTTCAGACAGCACACCCAGACCCACTAACAAAGCTCAATGTCCAGCCACCACCAGTTGCTCCAAAACCTGCCAGACCTTCAACAACCCTTTATCATGACGTTCAAGCAGCCGAAGCACAAAACAACAAGACACAGATGAATACACCTCAGACCATCCCCACTGTTCCTGTTATGGTGAATGGAGATGCTTCGAACACAACTGTGACAGCCCCCTCTGTGATGCCCAAAACTAATCTCTCAGTTCTTT
(1)
OTHER sa22279 PAGES
ZMP:sa22279 (1)
GENOTYPES No data available

CITATIONS  (1)