ZFIN ID: ZDB-ALT-131217-16660
Genomic Feature: sa22672
Synonyms:
Affected Genomic Regions: nf1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 15: 30955303 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GGAGGTGTGTCTGTACACGTTCCTGTGGAGTCCTGATGCAGAGGCTGTTT
T/A
GGTGGCCATGTCCTGTTTCAGGCATCTCTGTGAGGAGGCCGATATTCGCT
(1)
OTHER sa22672 PAGES
ZMP:sa22672 (1)
GENOTYPESNo data available

CITATIONS  (1)