ZFIN ID: ZDB-ALT-131217-14592
Genomic Feature: sa18590
Synonyms:
Affected Genomic Regions: nab1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 22: 12890477 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AGCCTTGCGTGTGTTCATATTTGTCGAGTCTTGATTATCTGACATTACGACAGCCGAGATCTTACAGTGTGTATCATGTTTGGCAACAGTCTGACAAGCTACAATTGAAAATGGTAATTAAAAATTGCAGTGTGAGTCGGGAGATAGAAGAACCAGCCAAACCTCATGCATTGTAAGCTGCCGTCCGTCCCGCCTCTTAGAATCAAATCGCCCATAGATGGCGCTGTATTTCCGAATCTCCACCTCCTTTTGTGGATCGTCGTCACTCATCTCGCAGATGTGGCCGATCATCTTACTGAGCTTCTTATTAGTACGAATGTGTTCTTTGACCTCTGTAGGATCACTCTTGGACAGAGTGTGGGAGAGCCGCTCTACGCACTCCATCACACACTGGACGCCAGCCGAATCAAGAGTATCGAGAGCATCATGAGGTGAACACGGAGAACACGCTCCTGATGGAGATAAACTATGCTCGCTCTCGCTTCCCCAGAAACGACTTT
C/A
ACTTGCTCCTTGTAACGGCGAGCAACCTGGAGTCCCGTCCCTGCTGAGATCAAGCCTTCCGGGACTGGGGCTTGTAGGTAATAAAGCCCTAGGAACGACGAGCTGGTTTTGTTGCCCATTGCTGTGGACGCCGGGGGAACTTTCGGGGAGCTTGTACACTGGGATACTACAGACAGGAAGAGACGTCAATGGTTGGTTGAAGAGGGAAGGATTGGTTACCCAATCCCGTAGTGCCTTCTGGAGTCGGCGAACATGGAGGGGTTTGGTTGCCATTCCAACAAGGGCCATGATTTCAAGGAACTCTTCCTCGCCAGCCTCGCAGAGTTGCTGCACATCATCGCCGCCCTGCTGGATGAATGCTTCATAGTAGCAGAGCAAGTTTGCCTTCTGCAGGATGCGATAGAGTTGAAGCTCGCCCAAGGATCGTGGCAGGAGCACTGACATGGCTACATGTGCAAAAATAAAACAAGTCAAGCTTGTCCAATCGACAACATTTTACT
(1)
OTHER sa18590 PAGES
ZMP:sa18590 (1)
GENOTYPES No data available

CITATIONS  (1)