ZFIN ID: ZDB-ALT-131217-12093
Genomic Feature: sa13660
Synonyms:
Affected Genomic Regions: ntrk2b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 55686664 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ATTTCTGTTTGGAGTTTGCATGTTCTCCTCAAGTTCGCATGGGTTTCCTCCAGGTGCACAGTCCAAAGACATGCACTATAGGTGAATTAAATAAACTAAATTGGACGTAGTGTATGAGTGTGTGTGAATGAGGGTGTATGGGTGTTTCCCAGTAATGGATTAAAGCTGGAGGGGCATCCACTGCATAAAACATATGCCAGAGTAGTTGGCAGTTCACTCCACTGTTGTGACCCCTGATAAGTAAGGGACTAAGCCAAAGAAAAATGAATGAATGAATATTATTAAATGGTAAGAGCATAATAAGTGCATGTGCTTTCATTAATCAGTGCACCCCCTGTCAATTTATGTCTCACATCGCAGGTGGGTGGTCACACCATGCTGCCCATCCGATGGATGCCCCCAGAGAGCATTATGTACAGAAGATTCACCACAGAGAGTGACGTGTGGAGTTTGGGTGTAGTACTCTGGGAAATCTTCACCTATGGCAAGCAACCCTGGTA
T/A
CAGCTCTCAAACAATGAGGTAAGATGCTACCCAATCAATCATTTGTCTGAAAATAAAGAACTTTCATCATTTAGTCACAGAAATTAGTTATTCCCAATGTTCGTATGGATGCTGTAAATCCTTGAACATGCTTGAAAATTAATCTAGTGGTTTCAAGGTTTAAAGAATAGCTTGAAACTGCTTGAAAATTTGTTAATTATTCACTAAAAAGTTAATCAGTTAAATGTTGAAATAAAATAAATAGTTTTGCTTTTGCATAAATGAAAACCATAGTTTTAAATAATGACTGTTACTGTTAAATAAATAACTGTTTTAAATAATGGTTTACACTGCATTGTTGATTTCATTGTTGGAAAAAAATCAATCAAGCATAATCCTGTGCTTTTGATTTTGTTATTAAAAAAACTAAAGAAAAACAAGCAACCATGTATAATGAGAATCTGAAATATTTGATGGCATACTTGTGTTCAAAAATGTTTTATTTTTATTTAGTTTTTAAG
(1)
OTHER sa13660 PAGES
ZMP:sa13660 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ntrk2bsa13660/sa13660 ntrk2b ♀+/- ♂+/-

CITATIONS  (2)