ZFIN ID: ZDB-ALT-131205-6
Genomic Feature: nig1
Synonyms:
Affected Genomic Regions: dhx37 (1)
Type: Point Mutation (1)
Protocol:
Lab Of Origin: Hirata Lab
Location: Chr 8: 4541231 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Leu>Pro at position 489 (1)
FLANKING SEQUENCE (GENOMIC)
CTAACTTCTAGCAGCTAAATGTGTCTGGAAAAATATTCAAAGGCTCTTATTCTCACAAACCGCGCGGACGTAAATGCGTCTGACTGTTGTGATTGGCTAAAGCAGACGTCTCTCGTCAGCACGTTCTAGACGTGCACACGCTTATTACGGCAATCTTCCTTCTGCGTTCACACAGCGCAGCATTCCGGCAAATTACCGGTAATGTTACAACTTCTCTTACCGGAATATAGCCAGAACGAATTTACCGGTATTTTCAAAAAGGACCTGTTTACACATACAACCTTTCCAGAAAGGTCTGTATGTGTGAAAGGGGCTAATGACTCTAAGAAAGCACACTCTGACTATTGTAACTTTGCAGAGCTTCTACATTCACAAACGGGTACATGTACATACCACATTAAAAGTAACATCAAATGAGGCATAATTGGATGACACTAGATGAATCTAATCAGTGCGTACCTGTGTGCTCTCGGTTTGGTTTATAAGGGAAAGCTTTTCTC
A/G
GCCTCCGACACACAGAATGAACCTCAGCTTGACCCGTCAGAAACACCAGAATGCCACCTGCAACACACACATGTAGGAGAAGTCAGAATTATTAACCCTCCTTTATAATTTGTGCCCTGAATTTCTGTTTAACAGGGATATTTTTTTCAACACATTTCTAAATATAATAGTTTTAATAACTCATTTCTAATAACTGATTTATTTAATCTTTGCCATGATGACAGTAAATAATATTTGACAAGATATTTTTCAAGACACTATTATTCAGCTTAAAATGACAGTCAAAGGCTTAACTAGGTTAATTAGGCAGGTTAGAGTAATTAGGCAAGTTACTGTATAACAGTGGTTTGTTCTGTAGACTAATGAAAAAAGGTGGCTAATAATTTTGACCTTAAAATGGTTTTAAAAAATTAAAAACTGCTTTTATTCTAGCCAAAATAAAACAAATTAGACTTTCTCCAAAATAAAAAATATTATAGGAAATACTGTAAAAAATCCCT
Comment Citation
missense mutation (L489P) in an RNA helicase, DEAH-boxprotein 37 (Dhx37;  ... ZFIN Staff
OTHER nig1 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous dhx37nig1/nig1 dhx37 Unknown

CITATIONS  (3)