ZFIN ID: ZDB-ALT-130530-411
Genomic Feature: sa14677
Synonyms:
Affected Genomic Regions: cdh10b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 39724163 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
AACCGAAGGGGAACCCATTATAAATATGCTGTCATGTAAATGTTTACATCCAGGTGCATGTTCTGCTCTGAAGGAGCATTTGCCGTAATTGTGACTACAGTGTGAAGGTAAAGGAGTCAATTCACAAGTTTTCTGAGATATCTGCCATATGTCGTTAACCACGGCAAACACAGAGCTTTTTGAAATTCTGAAATTATTACTGACACTGCTGTGAAATTTCCAAAGAAAGAAAATTAAACCAAGTGGAGCCTTTGAGCAAATTCACATTCATATTCACATATTCATGACTCATTTAAAAAACATTGCTCAAGAAACTTGGGCCAGAAAGGGCTTAAACTGTGTTTAGCAAATGGTTTAATTTCTGTTTCCCTTTGCACAAGGTTTAGGAACATTTTTCCCTGACAGACTAAGCATATTTGCGCACAATTTGCCAGTCGCGCTAGGAAAACACTTAATTCGGGAACTGTTAATTCCAGCAAAACTCTCTTTGCTCTTTTTAA
A/G
GCTTCACTCAGACATGGACACGGAAGATGGAAATGTGAAGTACGTCCTCACCGGAGAAGGAGCTGGAACTGTTTTCGAGATTGATGAGAACTCAGGCGATATTCATGCCACCAGGAGGCTTGACAGGGAAGAGAAAGCGTCGTACACTCTGAGCGCTAAAGCCGTCAACAAAACCTCTGGACAGGATCTGGAGAGGGCCTCCGAATTCATCATCAAAATCCATGACATCAATGACAACGAGCCAAAGTTCGCCAAGGACACCTACGTGGCCAGCGTATCTGAGATGTCCAATGTTGGTGAGTTCAACATGTTCCTGTCAGATTCACAAAGATGAAAGGCTCAGTTCACCCAAAAATGAAAACTCGGTCAACATTCGATTTACTTCTACCAGAGTTATTTGAGTTGCTTTATTCTGTTGAATGTTGAAATGTGATAACAATTGACTCTAGAAGTGAATAGCTACCGGCTTCCAACATTCTTCAAAATATGTTTTGTTTTCG
(1)
OTHER sa14677 PAGES
ZMP:sa14677 (1)
GENOTYPES No data available

CITATIONS  (1)