header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-130411-75
Genomic Feature: sa10083
Synonyms:
Affected Genomic Regions: bida (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 18: 20571964 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CTTTACGCGAATGGTTCCTCCATTTAAATAGTATCACTTGCATATTTTCA
G/C
GTTTGGGCCAGTCATCTATCTAAAGGAGTGCAGACGTTACTTCAGCATGT
(1)
OTHER sa10083 PAGES
ZMP:sa10083 (1)
GENOTYPES No data available

CITATIONS  (1)