ZFIN ID: ZDB-ALT-130411-622
Genomic Feature: sa10699
Synonyms:
Affected Genomic Regions: zgc:101783 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 19736739 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
ATATCCATCAGGCAGTGGATATCATTGATTTTTTTTTTAAGAAAACAGACCTTAAATTTTGTAACTGCATACAGTTTAGTTCAGCGGAAGCACTTGACCCAGGTTACTGAAAATTTAAAAAATTTCTGCGTATACCCAATTAGATGCCCTTAAGTTCTAATTAAATGTAATAATTTGATTCCTCAATTACATGTGATACTGTGTAAATAATAAATCTATTCAGACAAAGAAGACTGTTATAGTATTTTTTTTTTTATTCTATGTAATCGTAATTTAATTTACTTCTACAGAAAAGTTGAAATTCATTTTGATGGTGGCTGCTTTCATGATATCCATGGGCCTTGTCCTCAAACTCCTGCAAATTAATCCAGAAGTTACATTATCAAATTTAATAGGTGAGTTGCCAATTTAAAGAAGATTTTATTTGTTTGATTATTTGTTTATTTGATTTCCTACTGATGCATGCAATGTATGGTATATATATATTTGTGTAAAACACA
G/C
AAAGGTCAGTGGATGAAATGCATTTAGTCCCGTCGAAACCTGATGTTGGTAAAAAGATGATGGAAATCAAACCTAATGGTAAGAAATTTCCCCCAAAAATATTATATTCTATTATGTAATAGCTGATTAACAGTAACCAAAAACGCTACTTCTGCTTATAATGAACAAATATTGTTTGTTGGTGTGGACGATAATATAGATATCTTAATAGTTTTTGTGCTTGATGTAATTGGGTGTTAAGGGTACACATTTAAATGCCCATTTCTGCTTGATTTTTACTCTGTTTGTTTTTGCAGTGCCTAAAGCCAAATGTGGCCTGGCCAAACCATGTCCTGCAGGTGGTTTGGCCTTTAAGATGTACAGCGGTGCAACTAATATAGTTGGACCCCAAATATGCTTTGATGGAAAAATGTAAGGATGTTGACTTCTCATGCATGATTAAATAAAATAGCATAAAAGTGTTATTTAAATCACAAGTGGAGTTTAAGCCAGTTCTGCAA
(1)
OTHER sa10699 PAGES
ZMP:sa10699 (1)
GENOTYPES No data available

CITATIONS  (1)