ZFIN ID: ZDB-ALT-130411-4707
Genomic Feature: sa16207
Synonyms:
Affected Genomic Regions: dnaja3b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 22: 26615498 (Zv9) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
ATGACCCTGATGCAAAGGAGAAGTTTGCCAAACTGGCAGAAGCTTATGAG
G/A
TGAGGAACATTTAATGCTCATTTTCCTTCTATATATTTTTTATTATTATT
(1)
OTHER sa16207 PAGES
ZMP:sa16207 (1)
GENOTYPES No data available

CITATIONS  (1)