ZFIN ID: ZDB-ALT-130411-3525
Genomic Feature: sa14898
Synonyms:
Affected Genomic Regions: usp2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 15: 20907928 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AGGGTCACGGTCCGGCCACGGGGAAACACAGAAGATTTTGACCACTTGCC
G/A
TAAGTGTACTATACTTATTTTCCTCCATATATATGCAAGATTTTATGATT
(1)
OTHER sa14898 PAGES
ZMP:sa14898 (1)
GENOTYPESNo data available

CITATIONS  (1)