header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-130411-3034
Genomic Feature: sa13408
Synonyms:
Affected Genomic Regions: jag2b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 21392191 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AACGAGCGACGTGGGAAAGATCATCATCCCTTTTCACTTCGCCTGGCCGG
T/G
GAGTCCTCGTCTTCTCCATGGGCTGTAATAAAAAAACGCGCCGCGGTGAG
(1)
OTHER sa13408 PAGES
ZMP:sa13408 (1)
GENOTYPES No data available

CITATIONS  (1)