ZFIN ID: ZDB-ALT-130411-2305
Genomic Feature: sa12592
Synonyms:
Affected Genomic Regions: pdzd3b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 30697090 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
GACGCCAAAGCCTGCAGTGCCTCCTGTTGAGCCTCAGGAGGAGGTGCAGATCAACCCTAATGTTAGACGCTGTATACTGGAGAGGGGCTCGGCTGGTTTTGGCTTCCATTTGGGCTGCGTCCAACAGAAACCTGGCACCTTCATCAGCCAGGTACAGTACAATGAAGCCCATTCACTGGCAAATCAGCCCTTACACGATACTAACTTTAGATGTTGAGACAGAAGAGAAATGGAGATTTTTTTTGGACTCACTCATCCGTGGTAATTCTTCACAAAAACCTGGAAAATCAGGCCACTTGTAGGCCTCATAGTAGACTGTGTAATATTCAGTCTGTCATTGAAATCATTGAAATACATAAACATCAAGTTACAGTTCAAAAATGAACTAATACAACTCAAAAACATATTCCTGCACACTATGGGTAAATGTATAATTTCAAGTAAATATGAGCAACAAACATCCTTTTTGCTTTTACTATAGCAACATGCATTACATGTTT
A/T
GGTAGCGGCAGGCGGTCCAGGACAGAGTTCAGGTCTCTTTCAAGGTGATGTGGTGGTGGAGGTGAACGGACAAAATGTGGAGAAAGAGTCTTTGGAGGATGTGATCATGCATGTGAAGAGAGGAGGAGAAACCCTTTCTTTACTGGTCGTTGATCAAAAAGGTTATGATTGGCTGAAGCAGAACGGGAAGCCAGTCACACTAAACAAATTAGAAACAATCTCTGAGGTACAGTATGCAGTATCTATTCATTAACGAGCACTTTTGTACTGCACAAACCAAACATTTTTTTTTAAAATTCACTATTAAACAATCTATTTGATTTATATATATTACTTTATTCATGTTACAGTTGATCATGTACTATTTGTTACAGGTGGAGGAAAGTGTTTCAAGTTCTGCTGAACCAGCAAGAGTGAAGACCGGTGACTCTGATGGCCAGACTTTGTCCATTTAGTTTCATTTAGGATGAGCATTTAAACAGACCTGATATTGTCCATTA
(1)
OTHER sa12592 PAGES
ZMP:sa12592 (1)
GENOTYPES No data available

CITATIONS  (1)