ZFIN ID: ZDB-ALT-130411-1736
Genomic Feature: sa11954
Synonyms:
Affected Genomic Regions: cdc14ab (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 22: 16221626 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GAGCAAGTCGCATTTCATAACGAAGGGGTGAAAAGGGGCATCATTACCTC
A/C
TAATGTTCATATTCGTTAACATCGAAAGTCTCGAAGTTCAAAAATCCATG
(1)
OTHER sa11954 PAGES
ZMP:sa11954 (1)
GENOTYPESNo data available

CITATIONS  (1)