ZFIN ID: ZDB-ALT-120803-2
Genomic Feature: zf340
Synonyms: mvo47a (1)
Affected Genomic Regions: smyd1b (1)
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: The Fishman Laboratory
Location: Chr 8: 1044752 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A in Exon 2 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Cys>Stop at position 73 (1)
FLANKING SEQUENCE (GENOMIC)
ACACACACACACACACACACACACAATGGGTTTTCATGCTTTATGGGCTCTCTCCAAAGTTGTAATGATGCTGCACACATCTACACCCACACACATCTACAACGGTGATCTACATACACACACACACACACACACACACACGCACGCACGCACGCACGCACGCGCGCATGAGCAAACCTATACGCATGCATGCACGCACACACTCACACATACATCTACACACAATACACTCACATACACACACATGTGAAAACACACGCACATACACGTATATAAATAAATCTATACACACACAAACAAAACACGCAAACTATATGGCGCCATCTAGAGTCTGAATAACGCTTAGGTTAGTGTATACTCCATCAGCTGGATGTACTTTATCCCTATAGTATGGCATGAGTGATGTGTTTGTGCTCGTACCGGACGTTTTCACTCGGCGGTTTTCCGTAGGTCTTGATGGCAGCACACTCCAGCTTGTGTTCCTCCCAGCCGGCGCGCTG
A/T
CATGTTTTGTCACAGTACTGCGCAAACCTGCACTGTCCGCAGCGCTGCAGCTTCTCCTGACGCCGGAAACAGCTGTGACAGATGCTGGACGCCTGGCTGCAGGAGGAACACAAATGACAACACACACATTCAAAGCCAGATTTTATATGTAACATACACACACACAGATGCAGCAAAATGCTTATACAACCAGCTGTGACCTTAAAACCGGCTTCTCTACTTATTTTGTTGTCTTGTTTCTAGTCTAAATATCTAAACATTCTTAAATCCAGAAGCATTTTCTAGACAAGCGAACTCTGTTTCATTCAACCCAAGCTCATTCTGGAAACGTAGCTCCGCGGATGTTTCTGGAGACCGCGATTTACGTGGCCGGAGGTACATAAGGCCGCGTTTAGTTTTTTCCGAGCGAACGCTGCGGGGCGGTGTGGCGCCGCTCTGCTCCTCCTCTTCGCGCTCGCCGGCCGACGGCTCCCCTCCGAGTGGAGGGCTTTCCCGATGCA
OTHER zf340 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous smyd1bzf340/zf340 smyd1b Unknown
smyd1bzf340/zf340 smyd1b ♀+/- ♂+/-
Complex smyd1bzf340/zf340 ; ulm100Tg smyd1b

CITATIONS  (7)