ZFIN ID: ZDB-ALT-120727-30
Genomic Feature: sa1513
Synonyms:
Affected Genomic Regions: bud13 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 22702835 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CATTAGCGAGACACATTGACGATGAAGACCTTGATCGCATGCTAAGAGAG
C/T
AAGAGAGAGAAGGAGACCCAATGGCGGCAATGCTTCGCAAGAAGAAAGAC
(1)
OTHER sa1513 PAGES
ZMP:sa1513 (1)
GENOTYPESNo data available

CITATIONS  (1)