ZFIN ID: ZDB-ALT-120727-159
Genomic Feature: sa684
Synonyms:
Affected Genomic Regions: gla (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 38940933 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
GGGAACCAAAACTGGTTATCAACATCCTATAAATATATTTTATCTGCATTGTGAAAGAATGAAGTAATGCATTCAGGTTTGGAACAACTTAAGGGTAAATGAAATTAAATTATTTAAATTTTTGGGTGAACTTTCCGTTTTAAGGGATAGTTCACCCAAAAATAAATGTACTCAATATTTACTCTCCCTCAGGTGGTTCCAAATTGATTTGACTTTCTTTCTTTTGTTGAACACTAAAGAAGATATTTTGAGGAAAATTGCAAACCGTTTCCTTCCATGCATGGAAGAAAAAAAGAAACCCTAAAAGTTAATAGTTTTTTTAGCTTTCTTCAAAATCAATTTTTTGTTTGACAAAAAAAATGAGGTTTGGGATAAGTAAAGGGTGAGGAAATTATTACATAACTTTTTTAGGGGTGAACAAAGTGTTGTGAAAATACAGTAACTTACTGCATCTTTAATTAAAACATTTTCAAGCATCTCACCTGTTGGTGCTGCCACTC
A/T
TATAACGGCCATTCACAAGAGTAAACAATACTTCTGCCAGTCTGGTTTAGTGCACTTGACATATTTATATAACCTAGAAAAAAAGTGTAACACAACAAAGCCATTTCTTAGTAAAACTCCAAAATCTATTAGGATACAGATGAGACTTGAATATCCAAGCAGATGCAGATACAAGCAAATGAGACTTGAATATTTATTTGTTCATTATTTATTGCCACATCAGCAACTTAGGGCCATTTCATGGCAAAATGGATATACATAAAATATTACATGATAAAACAAATTCGTATTACAGTAAAATATTACATGGACAAATATATAGGATAGAAATAAATTAAATTCACACAAAAATATATTCAAAGTTAAATATGATTTTTCAGTTCAATTTTTGAAAAATAATTTCAGATTCTTCCTGGTGGTACCTTTTTAAAAATGTTGATGAGACTTGAATATCCACTCACCTTCTCCCAGCTGATGCCAGTCAGGCATGAAACACCCGT
(1)
OTHER sa684 PAGES
ZMP:sa684 (1)
GENOTYPES No data available

CITATIONS  (1)