header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120727-149
Genomic Feature: sa574
Synonyms:
Affected Genomic Regions: aox5 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 22: 14092242 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TCTACATGGAAACTCAGGGAGTGATTGCAATTCCTACAGGAGAAGCAAGT
G/T
AAATTGAGCTATATGTTGCCAGTCAGCATGCAGCTTACACTCAGGTTTGT
(1)
OTHER sa574 PAGES
ZMP:sa574 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous aox5sa574/sa574 (TL) aox5 ♀+/- ♂+/-

CITATIONS  (3)