ZFIN ID: ZDB-ALT-120411-67
Genomic Feature: sa127
Synonyms:
Affected Genomic Regions: lmod1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 28301636 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CTTCCCTCCGCAGATGTGTCTCTGGTTATGAAACCTCAGCTCCATCAGTGCGCTGTTGTGTTGAAGAGAGTTGATGATGGCCAGGATGCCCTTGCCTGTCAGATGATTAGAGTCGAGGTTGATGCCGGTCAGGGTTGAGTTTTCTCGCAATGTTTTAGCGATGGCGAATGCGACATGATCATCCGCTCTTGTGTTTGCAAGGCAGAAGGTTTTGATGTGAGTGTTACTGCGAAGACCCTCTGCAAACTGAATCAGGGTATCTGTTTTAATGGCATCTGAATTGTTGACGTTGACCTCAGTTAGTTCAGGATCGTCACTGCGAACCTGCTCTAGAAGATCGTCAAACATGCTGGAGCCAGTGTCACTGTCCAGATCTTCACTATAAGACTCATCCTCCTCAGTAGTAAGTGAACAGGTGTCCGCTCCATGACAGTTCCCTGAGCTTTCATGGAAAGAACTGGTAAAAATCTTGGCCTTGCTGTTTTCTGGTGCTTTCACTT
G/A
TTCTCTCTCCTTTTGAGGTCTGGTTTTATCCAAACTTGTTTCTTCAACTGTACTAAATCTGCTGTTTTTGTCGTCTTTTTCTGCATCTATTAAGTTTACTCGTCCTGCTTTGTTGTTTTTGGGTACCTCTGAAGCTTTAGTTCTGCTTCCATCTTGCTGTTTGACGTCCGTCTTTTTGTCCTTTTTTTCCTCAGTCACTTTATTCCCCTGAAGTTTGGAGACAACCCCTCGTATTTTGGAGTTTTCGTTCACTTTCTTGTCATCCTTCCTCCCTCTGTCTTTCTTCTCCTCTTGTTTCTCTTGCAGTTTGGAGATGAGGTCTAGAGTTTTGCTGCCACCTTTCTCTTTCCTAGAAAGTTCTTTGCCACTTTCCATCTTATCACCTGTTCTCTTTTCCTCCCGTTTATTCTTTCCCTCATCAGATAAATCTTTAGAGTCATCCTCCCATTTTCTCGTTCTCTCCTTATCTTTTTCACTTTCAGCATTTCTGCTCTCTGTGT
(1)
OTHER sa127 PAGES
ZMP:sa127 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous lmod1asa127/sa127 (TL) lmod1a ♀+/- ♂+/-

CITATIONS  (3)