ZFIN ID: ZDB-ALT-120411-576
Genomic Feature: sa848
Synonyms:
Affected Genomic Regions: nf1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 15: 30963158 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CATTTGTAGACAGTTTACGAAAGGCTCTTGGCCAACACAGCGGCAGCAAA
C/T
AATTGACGGAAAGTGCAGCTGTTGCATGCGTCAAACTCTGCAAAGCCTGC
(1)
OTHER sa848 PAGES
ZMP:sa848 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous nf1asa848/sa848 (TL) nf1a ♀+/- ♂+/-

CITATIONS  (3)