ZFIN ID: ZDB-ALT-120411-497
Genomic Feature: sa963
Synonyms:
Affected Genomic Regions: abcc6a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 11053231 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CAGATCTGGACAATCTACCTGCAGGAGATGCCACTGAGATTGGAGAGAAG
G>A
TGAGACACCTATGCTTTACCCAAAGTAGAGTAATGAGCTAAAGTTATATT
(1)
OTHER sa963 PAGES
ZMP:sa963 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous abcc6asa963/sa963 (TL) abcc6a ♀+/- ♂+/-

CITATIONS  (3)