ZFIN ID: ZDB-ALT-120411-492
Genomic Feature: sa919
Synonyms:
Affected Genomic Regions: crebbpb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 9664216 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
ATAAAAATGACGAGTTGGATATGAAATTTAAGATCCCACATGAAATCGAAGACCTCCTTATGGAAAATTAGACATTTCTAGACATTTCAAAACTTTTACAGGACCCGCGGGGACCCTGTGAGAGTCTGAATGTAGCAGGAATGTTTGTGTGTCTTACCCTGCTGTTGGCAGACTCATACATGTCTCCCTCCACTTTCCGTGCATAAGCAACCAAATTCTCCATGCGTCTGTCTTTCAGTGCTGCAGGGTCAGGAGTCGGGAATATGGCTTGAACTCTGTAGGAGCATTAGGAGAACACACTGTGTAAAAAAAAGCAGCATATGACAAAACACAATATTGATGTTTGATCTGTTGAACTCACAGCTTGTGCACTAGGTGATTCCTCAGGTCCTGAGTGACGTGCTCGTGCCAGGGTTTCTTCATGCCGGGCATCGACAGCGGCGCAGCAGTGGGCAGGTTCCCTGCGCCACCCATATTCGACCCGTCGGGCATCATCTGGC
A/T
GTGGGTGCGGGATAATAACATTAGATTATAAACCATGCTTGACATTTTTTGATCACCAGCCGCTGTTGATTACTAGCCACTCGCCATTTTCACTAGCCACACATTTGTTGTTGGAAAATATATTTTATTTGCATAAATTTGACATGCTAAAATGTCTTGATTTAGATTTTGTGTTATATCCACATGCCTCCATTTCACTTTTTGTGTGTGTTGTGTATGAGCTTGCTCAGTGTGCATGAGCATATGAGTTGAGGTCTCATTGTCGCATTGCAAATATTTTTTTTTTATTTCACATGACTTTCTGGGGCTCAAAATTAAGGATTTGCCAAATTTAACTCTGACCACACCAAAAATAAATAAATTATTATTTCTTAGCCACAAATTTTAAATAATGGGTCAAAACAAGCAAAATATAGCTGTGTACATGCACTTTTAATTCAACAAATCTTTTCTTTAAAAATAATTGAAATTTTAAAAATGATAATTGTCATGTATATCTA
(1)
OTHER sa919 PAGES
ZMP:sa919 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous crebbpbsa919/sa919 (TL) crebbpb ♀+/- ♂+/-

CITATIONS  (3)