ZFIN ID: ZDB-ALT-120411-469
Genomic Feature: sa799
Synonyms:
Affected Genomic Regions: pmelb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 35677395 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AGACAGGGAGACAAGCCACCTCCATATGTGTTTGTATGGAAAACCTGGGG
T/C
AAGGAAAGCAACTGCTGTACTGCAAGGTGCACTTTTACACCTGGTGTATT
(1)
OTHER sa799 PAGES
ZMP:sa799 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pmelbsa799/sa799 (TL) pmelb ♀+/- ♂+/-

CITATIONS  (3)