ZFIN ID: ZDB-ALT-120411-338
Genomic Feature: sa3049
Synonyms:
Affected Genomic Regions: gnpat (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 4174257 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GTTTGGCAGAACGGAAAATAAACCGATCTCAATACAACCTGCTGCCCAGG
T/C
ATGACACTGCATTCAGCCACGTTCTGCCGTAAAGGCCTTCATCATTCACA
(1)
OTHER sa3049 PAGES
ZMP:sa3049 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous gnpatsa3049/sa3049 (TL) gnpat ♀+/- ♂+/-

CITATIONS  (3)