ZFIN ID: ZDB-ALT-120411-317
Genomic Feature: sa1937
Synonyms:
Affected Genomic Regions: taf1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 36563373 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TGACCTAAACTACAACTGAAGTTTACTGTGTCCACACACAGATCTTCCTG
A/G
CCTTACGGAGTGTGTCCAGATCCATGGGGTTGATGATGACTTTATAATAG
(1)
OTHER sa1937 PAGES
ZMP:sa1937 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous taf1sa1937/sa1937 (TL) taf1 ♀+/- ♂+/-

CITATIONS  (3)