ZFIN ID: ZDB-ALT-120411-274
Genomic Feature: sa1738
Synonyms:
Affected Genomic Regions: cyp26a1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 8956885 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GACGGACGAGCAAGAACTGGTGGAAGCTTTTGAGGAAATGATCAAAAACT
T/A
GTTCTCCTTGCCAATCGACGTTCCTTTCAGTGGTCTGTACAGGGTGAGTT
(1)
OTHER sa1738 PAGES
ZMP:sa1738 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cyp26a1sa1738/sa1738 (TL) cyp26a1 ♀+/- ♂+/-

CITATIONS  (3)