ZFIN ID: ZDB-ALT-120411-261
Genomic Feature: sa1720
Synonyms:
Affected Genomic Regions: jag2b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 21448262 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AGATCTCAATGGCTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGG
T/A
ATGTAGACTTTTAAGGTGCTGTATTGTCGCTTCAGCTAATTGTGCTGTTG
(1)
OTHER sa1720 PAGES
ZMP:sa1720 (1)
GENOTYPESNo data available

CITATIONS  (1)