header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-187
Genomic Feature: sa1503
Synonyms:
Affected Genomic Regions: csf1rb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 43867354 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
ACTTCCATACAACAAGAAACTGGAGTTTCCTCGAAATAAGCTGAAGCTTG
G/A
TACTTACACTCTCTGTTTTACTAGAGTATAATTTTGTAATGATAAGAAAT
(1)
OTHER sa1503 PAGES
ZMP:sa1503 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous csf1rbsa1503/sa1503 (TL) csf1rb ♀+/- ♂+/-

CITATIONS  (3)