ZFIN ID: ZDB-ALT-120411-158
Genomic Feature: sa1462
Synonyms:
Affected Genomic Regions: il6st (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 10: 5804123 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ACCCTAACCTGCCTAGTTAACCTAATTAACCTAGTTAAGCCCTTTAAATGTCACTTTAATCTTTATAGAAGTGTCTTGAAAAATATCTCAAGACAAAAATAAAATAAATCAAGAATTGAAAAATTACAAATGAGTTATTAAACCTATTATGTTTAGAAATGTGTTGAAAAAAAATCTTCTCTCTGTTAAACAGAAATTGGGAAAAAAATTAAGAGGGGGGCTAATAATTCTGACTTCAACTGTATACTGTAGATCACACCACTATATATAGTATCAATGAATAGCTTATTAATTCAGCTATCAAGTAATATATAAATCTCAATTTGAAACAAAAAGTGACACTTGTGACTTGTTTTCGTGGTCACAAATGCTGAACTTAAAACGTTGAAATTCTAAACATCCTGTAAACGTACCGTCATTTGATCTTGGAATGAACAAAATAGTTTTGGGAGACCCTCCGGCTGAATTGAATGCAGTTATTTCAATACTGGCATTTTCTT
C/A
TGGTGGCACTTCCAGTGAATACCTCTGGTTGAGCTGATCAGCTTTTATAACGTGACTTTCAAAAGCCTGGTTATCTTGACTGATGATCAGGGAATAGTTACACATTTTTCCATTAGCTTTCACAGGAGGCTGTAATGGGAAAGAATAATAATAATCATTTAAAAACAATTCATATTTAACTTGATCACTTGTTTTTTTACACTTGAGAGATTTCTAGCCAGCACAAATAGTATTACTGATATTTAAGGGCGCACACATACTATCCGAACCGTGCCCAGGTGCGTTTCACGATTCGTTTGACAAGTGTGAATCAGGCTCAGTCGTGGTTTAGTTGGCCGTCCCTAACTCGGTTGGAAGAGGTGTGCCAGAGCACGGTTCACTTGGGCTTTGGCACTGTACGCTTGTAGTTTGAGTGCAAATCGCGCCTGAGCCCGAAACTGAAGACGCAACGTGACTTTTAGGAGACTGTTTCATATTTATTTATTAATCATTCTTAACTT
(1)
OTHER sa1462 PAGES
ZMP:sa1462 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous il6stsa1462/sa1462 (TL) il6st ♀+/- ♂+/-

CITATIONS  (3)