ZFIN ID: ZDB-ALT-120411-121
Genomic Feature: sa1359
Synonyms:
Affected Genomic Regions: sema3c (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 4: 22637772 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CCTGTGGGAAGGAAACCCCTGGTGGTGCGAACGCATGCCGACTACAAATA
C/A
ACCTCTATAGCGGTGGATCAGGTCCCAGCAGCAGACGGCCACTACCAGGT
(1)
OTHER sa1359 PAGES
ZMP:sa1359 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous sema3csa1359/sa1359 (TL) sema3c ♀+/- ♂+/-

CITATIONS  (3)