ZFIN ID: ZDB-ALT-090715-3
Genomic Feature: fh278
Synonyms:
Affected Genomic Regions: nrp1b (1)
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Moens Lab
Location: Chr 2: 43488245 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A at position 347 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Leu>Stop at position 116 (1)
FLANKING SEQUENCE (GENOMIC)
GTTTCTAAATATGTTTGGTGTCTAAAATATTATTTTAATGATTATATCTGCTCAATAAATCTGTTTTGTTTAAATTCACACCAAAATACATTGCCTATATTCACTAAGAAATGGATACAAATATTAATTTTCAAAATAGGGTGTTCTCAATTATACTGAGCACTGTATATATATTTTTAAATATATATTATGCATTAAAATGTGCATTTATATTTTTGTTATTTATAATTTTGCCTAGAGTGTGAGATTTATTTTAAGACTTTTAGAATGTAAAACAATAGGAGTATCCACATGCTGCTTATAATGTTGATCTATATTATGTTTCATATAACTGAACAGCAAATATAATCAGTCATCCCACTAAAGTGTTTGTGTATGTGTGTGTTTGTGTAGGTATGATTTTGTACAGGTGTTTGATGGTGCGGATGAGAACGCTCTCTCTCTTGGGAGGTTCTGCGGCAAAATCGCTCCGTCTCCGATTATCTCTAGTGGAAACTCTT
T/A
ACTCATCAAATTCACCTCCGACTACGAAAGCGCAGGAGCCGGATTCAGCATCCGCTATGAGATACACCGTACAGGTATACACAAACACACACACTGTCAAAGATATCATAATGCACACACACACAAAGACAAACATATGGTCTTTAATTAAAATACTCATTCTCTGTTTTAATTCTCTTTTGTACAGTTGAAGTCAGAGTTATTAATCCTCCTGAATTATTAGGCGAGAAGATTAATTTCTAAACATGATAGTTTTAATAACTCATTTCTAATAACTGATTTATTTTATCTTTGTCATGATGACAGTAAATAATATTTGACTAGATATTTTTCAAGACACTTATACAGCTTAAAGTGATATTTTTTTAAGGCTTAACTAGGGTAACTAGGCAAGTTAGAGTAATTCTAACAATCAAAAGACAATCAAATAAACATATTGCTTAAGGGGGCTAATAATTTTGACCTTAAAATGGTTTAAAAAAATTAAGAACTGCTTTTAT
(1)
Comment Citation
Mutation T347A gives a coding change of L116*. ZFIN Staff
OTHER fh278 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous nrp1bfh278/+ (AB) nrp1b Unknown
Complex p201Tg ; nrp1bfh278/fh278 ; p202Tg nrp1b
p201Tg ; nrp1bfh278/fh278 ; zf1062Tg nrp1b
zf1063Tg ; p201Tg ; nrp1bfh278/fh278 nrp1b

CITATIONS  (5)