ZFIN ID: ZDB-ALT-090619-1
Genomic Feature: ru1000
Synonyms:
Affected Genomic Regions: tmie (1)
Type: Indel (1)
Protocol:
Lab Of Origin: Hudspeth Lab
Location: Chr 2: 2223902 - 2223904 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 2 bp inserted / 3 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TAATCTACTTAAATTTGTAAATAAATTATCAAGTTTACTTAATAGATTTGTGTTAGGACAAGCATTTTTTACAGTTCACCTTAAAACCTGTTGCAGACCCTTCGGCTAGGCATATCACTTAACAATCATCACACAAAAACACGAACATGTGATCACAACACAAGGCCTTACACAACTATATGTGTGTGTGTGTGTGTGTAAGTGTAAGTCCCTTCCCCCAGCAGCTCTCGTAACCTCTGCGTGCTCCGGCGACAAGCCTGTAAACCACACCGGGGCTATTAATTAATTAATGGCCTTCAGTCCAGCGCCTGGCGTCCTCAGAGCAGGACTGCGAGCATTTGGAGACCCACAAAAGCATTAATGTAAAGGGAGGAGGTGGCCGTTTTTTCCCAAAGGCCATCAATCACCTGCACTATTGTGGTCCTGCGCAGTTTTGTTTCGTCCAGGCTGAAGGAAGGGGAGGGATGAGACGCGGGAGAAGAAGAGGGAAAATGGCGATG
GAG/AA
GGGCCTGGGAATCAGCCGCCATCCCTGGTCCCTTTGCTGATGAGCGTAACGGCGGTGTTGATCTCACATCATTTCTTTAACGCGGCGGCCCAGATACCAGACCCAGAGGTAAGACCTGCTTGTGTTTTATGAGGCCTAAAGCTGCTCTGCTGTTGATGTTCGGGCGCTTTATATTAAATAGACTGGCGATGGCGGGTTTTTATTTTTATGGCAGTCAATACACTGACACAGCTGCGGCGGTCTGGATGACAGCCGCATGAGGGTTCAAACAAATAGATGTCTTTATTGGAGAACATTTTCGTAATTCTGTTAGCATTTACTCTCCTTTTACTTGTTTCTGACCCGTATACTTTAAACACATGCGGCCCTGTCATTCACCCTGCACTATAAGGCGGGTTTGGCGCGATTTGTTGCTATTTTCAGACACGCGCAACTTTAATTGTCAGGTTTTGCGCCACGCTGTTTAAATAACAAATCCATTTGCGCCACTTTGTGGACTC
Comment Citation
There are two changes in the thirteenth codon, a G-to-A transition, and a  ... ZFIN Staff
OTHER ru1000 PAGES No links to external sites

CITATIONS  (11)