ZFIN ID: ZDB-ALT-090610-6
Genomic Feature: hu1999
Synonyms:
Affected Genomic Regions: rag1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 25: 9007943 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGATCTGGAGGAAAAATCCCTTCTCAGAGTCAGCAGACGAACTGCGTGAC
C/T
GAGTCAAAGGTGTTTCTGCTAAGCCTTTCATGGAAACCCAGCCTACTCTG
(1)
OTHER hu1999 PAGES
ZMP:hu1999 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous rag1hu1999/hu1999 rag1 ♀+/- ♂+/-
Unknown rag1hu1999 rag1 Unknown

CITATIONS  (14)