ZFIN ID: ZDB-ALT-080910-2
Genomic Feature: hu1435
Synonyms:
Affected Genomic Regions: ptenb (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: den Hertog Lab
Location: Chr 12: 17414932 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CATTTATCCAAATCTTCACAGAAAGGTTTAATGAGCTCTAGCTGAGGAGGATTGTGATCCTCAAATGGATACTGTGCAACTGCAAAAGATAAATAAAGAGATCATTGAGAGACCATCAACGTTACCACACAAAAACTGACATTTATGCAATCCAAGCCTCTTACCTCTGCAGTTAAATTTGGCAGTATCGTAATGTCTTTCTGCACATCTAAACAACACAAAGTAAAGCAGATAAGTACACAAGTTCAACATAATACTTTTCTGCTTAGAACTTTGCACCAATGCCAAAACCAACAGAACAATCGGAGTTAAGTAAGGGATCTATGTGCAATGACAAAGCCCTCCATTCACAACGATCAAACAGCCGCCTTAATCTTCAAGTGAACATGATTGCAGCTTTCAGAACATTCTAGCAGTAAAAGCAGTTTGATGAAACCCATTTACAAAACCGATATCACAGAACTGAAGTTTTTGAAACACACTTACAGGTTATATATCTT
G/T
TAATGATCTTTATGCTTTGAATCAAGAAACCTGCAAAACAAGATAGAACAAAAGCATGTTATAGATTTTAATTAAAGGAATAGTTCATCCAACAAAAGCTCAACAAAAAAACAAAAAAAAACAAATGAAGGTATTTTAATGGAACTGGATTTCTGTTCTTTCATTGAAAGTCCTTCAAAATAGTTATGCTTAAATGTAATCAATCCGAATCAAGTGCTTTAAAGCAAGTCTCCTGAAATGGACTTGATGGACAGATTTCATTTAGGTTTTTATTCACTTACAAATACTGATTAACACCTTACTGGTTCATATGGAAGATCAAATGTGCTAGTGGGACATGAGACCAAGCCTCATTAATTCTCACGTCAATCAAGTACAATTGAGAGTCAAGTTTACAATATTTACAACATATGTCAGATGATCAATTGTTATATGTTAATAAAATCCTTAATTTATAACTTCATGTCTCTTCAGAAGATTAAAACTGATTTGCTTTTAAA
(1)
OTHER hu1435 PAGES
ZMP:hu1435 (1)

CITATIONS  (18)