ZFIN ID: ZDB-ALT-080910-1
Genomic Feature: hu1864
Synonyms:
Affected Genomic Regions: ptena (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: den Hertog Lab
Location: Chr 17: 23668504 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AAAGAGACCATAAAAAGTAGTCTTTTTAACACTAGTTTCAGAATTAGACACTGTTAAAATGAAGTAGGGGTTGTACTCACCTCTACAGTTGAATTTAGATGCATCGTAGTGTCGTTCAGCACATCTAAAAAAGAAAATCAGGAGAGTTAAACTCCGAACAAACAATTTATGTTTGGTATGTCATTACTCAAATATAATTAAATACTTACAGATTATAAATTTTATAATGATTCTTATGCTTGGAATCTAAAAACCTGAAAGACAAAAAAATTAAGAAAGACAGAAGTTACAATTTTGAATTTCAACAAGCTATTAGATGAAACAACTGACTAACATTTGTTAGTGACTATTCATTCAAAAAAAAATGCATAATTTGTCAAATTTACGGTGAGACGAAATAAAAATAAATAAATAAATAAAAAAAAAAAGAATTGTGTGTTTTACCACGTTGACTTACCGGACAACGTCATCAATGTTGTTTCGGTAAACACCTTCCAATC
G/A
TTCGGCTGGAAAGCCCATGGCAATGATGTTAGGGTATATGTCTGACATGTGTGTTAAAGAAAAAGATCATATGTGCACTGTACACCAGGTTAACATTAAGCAAAATAAACAATAAAATTAAATCTACAAGATGTTACTACATACATTCAACAATCTAAACAAGAAACTAGCGCTGCGTCTTATTAAAACATTATCATCGTAACAATAGTAATAAATGAAATATGTCTCACAGAATGGTGCAATAAAAATATTTTATGTGCCAAATATTTATGTGCTAAAAGCATAGGTTGTTAACCCAAATTTGAGTAATCAACCGGGACCTTACTTTCTGTGCACCTGCCTCCCCAGTAGGTTTTACAATGCTACTGGCTAGAGCAGGCCCAAAAGTAAAGCTATAGTGCCTTAGAGCAGAGCTGAAAATAAATACTGATTGTGAGAGAAGAGACAAGCAAGAAAAATGACAACAGTGAATAAAAATTTTAAAATCAGCAGAGGCATTC
(1)
OTHER hu1864 PAGES
ZMP:hu1864 (1)

CITATIONS  (18)