header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-080814-8
Genomic Feature: hu3426
Synonyms:
Affected Genomic Regions: en1b (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 1: 7679604 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>C (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE
GTTCATTGCAACAAGTGGAATTTTGGTGTGCAGACCACGATCCAGCTGTC
A/C
TGGACGAGCAAAAGGATCAAAATAGTCGTGATTCGACTGAGTCTGAGAGC
(1)
OTHER hu3426 PAGES
ZMP:hu3426 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous en1bhu3426/hu3426 en1b ♀+/- ♂+/-
Heterozygous en1bhu3426/+ (AB) en1b Unknown
Unknown en1bhu3426 en1b Unknown

CITATIONS  (6)