ZFIN ID: ZDB-ALT-080814-1
Genomic Feature: sa28
Synonyms: sa0028 (1)
Affected Genomic Regions: bmpr1ab (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 25958638 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 84 (1)
FLANKING SEQUENCE (GENOMIC)
TGGTGCAATTAGCTAAAATGTTGCTAGATTTGGTTTTATGTATGGGTGATATACAGTATATTGCATCACCAAAAATGACTGAGGGCATGTCCATGTATTGTGCGATAAGTAGGTATATTGATTATTGTGACAGGCCTACAATGTAGATGTTTTAATCCAATTATATTTATATAATGGTTAATGTGCTATAATTTGGTAATAGTTTTTCATGGTCACACCGAGTAATTTCCACACTGTAGAGTGACGTTTTCATATATTTATTATATTAAGGTTCTCGAGCAGCGTTACACTTACTTCCTGGAATAGGAGGTGGAAGTGTGGGCTGTAGGTCTCTATTACAGAAATCTGTGGAGCAGCACTCAATGGTCCGTCTGGTCTGAGCATTAGGAGAGTCCTAGACGACAATAACCACATTCAGTCAATCTTAATGCCTTAGCACTTAACATCTATTCCTCACTGTCTCGTTCATGAATTACCTTGCACTGGAAGTGGGATCCCTC
G/T
TACTTCATGCAGCCTGAGGTCAGCATCGCCTCGCCGTGCTCATCCTCCTCTATGATAGCAAAACAATGGCCGTTTGTCCTGGGCAAACACACAAAGGTAGTTTAATTCAGATTGTTCACATTTAATTGAGAAGAAGTGAGATGAGGATAGTGTACTCACTCGCAGGTGTTGTTTGTGGCATCTTCTGGGCAGTGGCCTGAACAGTAGCAGCTAAGGAAGCGGGCAGCATCCTCTGGGGCCACGGTGGACCCGTCTCCTGCCTGAGCTCGCCTTGGATCTGATCCAGGCTTGACTCCAGTGCCATGAAGCATGTAGTCTGGGTTCTGTCCCCCTAAGGTTAAAATAGAGGAAATCAGATTTTTTTTTAGATATCCCAGAATGTAACTGTGCATAGTATTTTCATCATTACTCGTCTATATTTATGCAATCGTGATGAATCAAATCTTGCTAGAGAAATCATTGTGTCAAAGCATTTCAAACCAATAAAACCAAAATGTACG
(1)
OTHER sa28 PAGES
ZMP:sa28 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous bmpr1absa28/sa28 bmpr1ab ♀-/- ♂+/-
bmpr1absa28/sa28 (AB/TL) bmpr1ab ♀+/- ♂+/-
bmpr1absa28/sa28 bmpr1ab ♀+/- ♂+/-
Heterozygous bmpr1absa28/+ (AB) bmpr1ab Unknown
Complex bmpr1aahu4087/+; bmpr1absa28/+ bmpr1aa, bmpr1ab
bmpr1aahu4087/hu4087; bmpr1absa28/+ bmpr1aa, bmpr1ab
bmpr1aahu4087/hu4087; bmpr1absa28/sa28 bmpr1aa, bmpr1ab
Unknown bmpr1absa28 bmpr1ab Unknown

CITATIONS  (9)