ZFIN ID: ZDB-ALT-080610-11
Genomic Feature: hu3425
Synonyms:
Affected Genomic Regions: jag2b (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 20: 21391889 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TTGTCTTTCTGTTTTTCAATGTATTTTTAGGTGTCCCAGTCCTCTGGCTA
T/A
TTTGAGCTGCAGCTGATTGCTGTAGAAAATGTAAACGGTGAGTTGTGGGA
(1)
OTHER hu3425 PAGES
ZMP:hu3425 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Complex gz15Tg ; jag1bb1105/b1105 ; jag2bhu3425/hu3425 ; jh1Tg jag1b, jag2b
gz15Tg ; jag2bhu3425/hu3425 ; jag1bb1105/b1105 jag1b, jag2b
jag2bhu3425/hu3425 ; jag1bb1105/b1105 jag1b, jag2b
jag2bhu3425/hu3425 ; um14Tg jag2b
jh1Tg ; jag1bb1105/b1105 ; jag2bhu3425/hu3425 jag1b, jag2b
um14Tg ; jag2bhu3425/hu3425 ; jag1bb1105/b1105 jag1b, jag2b
Unknown jag2bhu3425 jag2b Unknown

CITATIONS  (6)