Genomic Feature

w59

ID
ZDB-ALT-080206-1
Name
w59
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Brockerhoff Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 12: 5144668 (GRCz11) (1) Details
Nucleotide change
A/G
Variant Notes
The A to G single nucleotide change disrupts a splice acceptor site, leading to  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CGGCAAGCCATTCGAAGAGCAGGATGAACAGATTACTGAAGTGAGTGGCCACACGCTCACAACAGCTTTGACTCTTAGTATCATGTGCTGCGACTTTACTTTCTGTTTCATTGAACTTTATTTCAGGCTCTAACACAGTTCCTGGGATGGTCCGTACTGAACTGCGACACATATGACAAACTGAACCGGATGGAGTGGAGGAAAGAAATTGCAGAAGAAATGGTCATGTATCAGACCAAAGCCACTCCGGCTGAAGTCCAGCAGATTCTGGTTAGATGATGAGCTTTTTCCTGTCAGAAAAAAAGTCCAGTCTTGTTTTATAACATTGACTAAACATTTTATGTGTCTCATTAGAACACAAAGGAGAAGTTTGACCAGAACCCGGAAGACTGCGATCAGAAAGAAATGTACAAACTCTTGGTACGACCAGATTTCAGAGTGAACACGAGACTGATTATTAAAAAGGATGATTTACTAAATCCACTTTTATTTTAACACAC
A/G GAGAGCCAACATTCCAGAGGCCAAAGATGTCGATCTGCTAGAATTTAGTTTCAGTGACTTCCCTCTGACTGAAACCGATCTCATCAAGTGCGGCATTCGCTGCTTCTTTGAACTGGGAGTGGTGGAGAAGTTCAAGGTGCCAGCAGAGGTGAGACGTCCGCATCAACACACTAGACTTTGAGCAAGCAAGCTTTTCATTCGATGTTACATCACTTATTTGAAAACAAGTGTGCCCCCTCATGGGTTTAGATCCCAGAGAAGATATTTGCCATTTTAAGATTCTTAATATATCGTTGAGTGTGTGAAAGGCTAAATACACACAGTTTTATGACTCAAACGTAACTTTAAAGATGATTTACCACAAAAGACTTATGATACCTGAAGCTGCTCCATATCTAGGCCTATCAATTTTGTTGATAAACCTGAAGATGTACACTTAGATTAACTTTTAGAGCATAAAAGTGATCAGTGTTTTATTCTAAGTCAAATAAATTTACTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations