header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-071108-4
Genomic Feature: hu2131
Synonyms:
Affected Genomic Regions: ihha (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 9: 7359197 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGGGGACATGGGAAAAGGCGGCCTCCGAAGAAACTGACACCCCTTAATTA
C/A
AAGCAGTTTAGTCCAAATGTAGCCGAGAAGACACTGGGAGCCAGCGGGAG
(1)
OTHER hu2131 PAGES
ZMP:hu2131 (1)

CITATIONS  (14)