ZFIN ID: ZDB-ALT-071108-4
Genomic Feature: hu2131
Synonyms:
Affected Genomic Regions: ihha (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 9: 7359197 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGGGGACATGGGAAAAGGCGGCCTCCGAAGAAACTGACACCCCTTAATTA
C/A
AAGCAGTTTAGTCCAAATGTAGCCGAGAAGACACTGGGAGCCAGCGGGAG
(1)
OTHER hu2131 PAGES
ZMP:hu2131 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ihhahu2131/hu2131 ihha ♀+/- ♂+/-
Heterozygous ihhahu2131/+ (AB) ihha Unknown
Complex fam20bb1127/b1127; ihhahu2131/hu2131 (AB) fam20b, ihha
ihhahu2131/hu2131; xylt1b1128/b1128 (AB) ihha, xylt1
ihhahu2131/hu2131; trps1j1271aGt ihha, trps1
ihhahu2131/hu2131; b1212Tg ihha
ihhahu2131/hu2131; sqet332Et ihha
ihhahu2131/hu2131; zf132Tg ihha
Unknown ihhahu2131 ihha Unknown

CITATIONS  (14)