header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-070730-9
Genomic Feature: sa3
Synonyms: sa0003 (1), sst (1), stocksteif (1)
Affected Genomic Regions: cyp26b1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 25334736 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CAAACAGTTTGGCCAACTCAATAGGAGACATCCATCGCAAAAGGAGGAAG
G/C
TAAGGTCAATGTCCAGTTGTTTATTAGTCTGATTAGGGCTGGGCTAATTC
(1)
OTHER sa3 PAGES
ZMP:sa3 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Complex cyp26b1sa2/+; cyp26b1sa3/+ cyp26b1
Unknown cyp26b1sa3 cyp26b1 Unknown

CITATIONS  (7)