header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-070720-1
Genomic Feature: sa1
Synonyms: sa0001 (1)
Affected Genomic Regions: unc5b (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 29200757 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTGTTATTAGTAAGTGGAGGCTGGTCATCCTGGACAGAGTGGTCAGAATG
T/A
AATGCTCAGTGTGGGCGGGGCTGGCAGAGACGGACACGCAGCTGCACCAA
(1)
OTHER sa1 PAGES
ZMP:sa1 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous unc5bsa1/sa1 unc5b ♀+/- ♂+/-
Heterozygous unc5bsa1/+ (AB) unc5b Unknown
Unknown unc5bsa1 unc5b Unknown

CITATIONS  (7)