ZFIN ID: ZDB-ALT-070622-1
Genomic Feature: hu1919
Synonyms:
Affected Genomic Regions: mlh1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Cuppen Lab
Location: Chr 13: 42607232 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TTTTATTATGGATAAGCACATCTTTTTAATCACCTTGTTGTCTTCTAGAT
C/T
GATTGGTGGAGTCTAGTGCCTTGAAGAAAGCAATTGAGACCGTCTACACC
(1)
OTHER hu1919 PAGES
ZMP:hu1919 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous mlh1hu1919/hu1919 (AB/TL) mlh1 ♀-/- ♂+/+
mlh1hu1919/hu1919 mlh1 ♀+/- ♂+/-
mlh1hu1919/hu1919 (AB/TL) mlh1 ♀+/- ♂+/-
mlh1hu1919/hu1919 (TL) mlh1 ♀+/- ♂+/-
Heterozygous mlh1hu1919/+ (AB) mlh1 Unknown
Unknown mlh1hu1919 (AB/TL) mlh1 ♀+/- ♂+/+
mlh1hu1919 (TL) mlh1 ♀+/+ ♂-/-

CITATIONS  (8)