ZFIN ID: ZDB-ALT-070601-1
Genomic Feature: st60
Synonyms:
Affected Genomic Regions: sptan1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Talbot Lab
Location: Chr 21: 13188928 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Glu>Stop at position 1491 (1)
FLANKING SEQUENCE (GENOMIC)
GACATCAGGTGCGTAAAAACACCTATACAGCATTGCAGAAGAGTTTTCCTTAACATCTTTTTAATACACTGACATGTTCACATTGTGTAGGAACACCGCACTGAGATCGACGCTCGTGCAGGAACCTTCCTGGCTTTTGAGCAGTTTGGACAGCAGCTGCTCGCTCGTGGGCATTACGCAAGCCCTGAGATCAAACAGAAGCTGGAGGCTCTTGACCGGGAGCGTGCTGACCTGGAGAAGGCCTGGGTTCAGCGCAGGATGATGCTGGACCAGTGCCTGGAGCTGCAGGTCAACAGAAACCCTTGAGTACATCTCATACAACTCTTGGATGTTTGAAGATGTTTCCCTCAAATGATGCCATGTTCCTTTTTTGTCTCCCTCAGTTGTTTAACCGTGACTGTGAGCAGGCTGAGAACTGGATGGCTGCCCGCGAAGCCTTCTTAGCCAGCGATGACAAGGGAGATTCTCTGGACAGTGTGGAGGCGCTCATTAAGAAACAC
G/T
AGGACTTTGATAAGGCTATCAATGTGCAGGTCAGACGATCATATGATCAAGTTCTAAATCTTTGAATTGTTTGAATGTTTTTATTCAGAACTAATCAATTCAATTCATGAATTCTCACAGGAAGAAAAGATTGCTGCACTGCAGTCTTTTGCTGACCAGCTCATCAGCGCTGACCACTATGCCAAGCCTGAGATCTTCAAACGACGCAGTGAGGTCTTGGACAGGTCAGTGTTCTCTTTTTTTTCCTGCTTAGATTGAGTAAATAGGTTGACATTTGGGGTTTGAGCTTATGTTTGAACTTACATTTTAAGCCAAGTTAAGGTTTGAGTTAATGTTTGTGAATACGTTTGGGTTGATGTTTGAGCTCACGTTCTAGGCAAAAGTAAGATTTGGGGTTAACGTTTGACGTTAACATTTTTGATCTTACGTTAGAGCAACGTAGATCTTGCCTTGATCTTACCTTAACATGTTTGATCTTACGTTAGAGCTTACATTTTAGG
(1)
OTHER st60 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous sptan1st60/st60 sptan1 ♀+/- ♂+/-
Heterozygous sptan1st60/+ (AB) sptan1 Unknown

CITATIONS  (6)