header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-070315-9
Genomic Feature: hu2024
Synonyms:
Affected Genomic Regions: myod1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 25: 31421995 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CACCGTCCCCGACCAGCTGCCCTCAACAGCAGGCTCAGGAAACCATTTAT
C/T
AAGTGCTTTAAAATTCTGCAACATTTCAAAACAAATTGAAAAAGACAATC
(1)
OTHER hu2024 PAGES
ZMP:hu2024 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous myod1hu2024/hu2024 myod1 ♀+/- ♂+/-
Unknown myod1hu2024 myod1 Unknown

CITATIONS  (6)