header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-070315-8
Genomic Feature: hu2023
Synonyms:
Affected Genomic Regions: myod1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 25: 31422131 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GATTGTCTGTCCAGCATCGTGGAGCGAATTTCCACAGAGACTCCTGCATG
T/A
CCCGTGCTGTCAGTACCGGAGGGGCACGAAGAGAGCCCGTGTTCTCCGCA
(1)
OTHER hu2023 PAGES
ZMP:hu2023 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous myod1hu2023/hu2023 myod1 ♀+/- ♂+/-
Unknown myod1hu2023 myod1 Unknown

CITATIONS  (5)