Genomic Feature

w21

ID
ZDB-ALT-030903-2
Name
w21
Synonyms
  • nof (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Hurley Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 8: 25233008 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T at position 154 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Gln>Stop at position 52 (1)
Sequences
Flanking Sequence
TGAACATCATAACATGCTTTTTAGAGAATCATTTTCACACTAATAATTGTTCTGTTTGTTTTAGAGCAGTCCTGCAGACCTGTGCAGATGGCGATCCAAAGTTGATTGACAGCATCTCCATGCCCCTGATGATGGCCAGAGCAGACTGCAGGATGTTGCCAAAAATAATAGATCGAAACTCCATTTGTTCTTCTTTTGTATAACCACCTTGATGGAGAATCCTTGGACAGGAACAAGAGGGGTTTTTATTAATGATTTGAAGATAAAGGACAGGCTCCTCATTCACTACCACCTAGTGATAACAGTTTAGGGTCTCAACTCTACTGTAGGTAAGCGCTGGTATTCCCCAAATGCACACTAAATGTTAAGGATTAATTCAGTTAGAATGCAAGAAACCTAAATCTCAATTCAAGAGCTTACACAGCTTGTCTACAAAGATACAAATTGTCATATCTGAGCATGTGTTTTGTATATCGCATGTGTTTCAACTCACTTCATCT
G/A TTTTACAATGGTGCTCTTCCCTGATTCACCAGCACCTATAAAACAAAGGGGAAAAAACATGATGTAGAGCAAATAAAGGACAAACGAGTCCTCAAACGCTTTTAAACCAAACATCACACAAAGTTTTGGCACGATGAACTCCATCTGTAACTTTTAACTTCATTCGAAGGTCTTTGAACAAACCACATTGAGCTGAATCTTAGTCCCTTGGTTACATATTCCATTGTGACATTGATGTATCACTTCATACAGATAACATAATGCCTGAATTTTTCCTGAATTTAAACCATTTGTTTTCCTCTCTATGGATATTGATTTTAATAACAAGGTCAATGTTAAGCTGTAGATAACCTGTCAAGAAAAACTCATAGATTGCCATTGATGGGCAGGTCAGAGGAAGGCTTATGAGCCTGCTTATAAAGTGACCCAATTGGATTTGTGTTAGGGAAAGCTTCTCAGAAGATCACTGACACTTTGATTCGCCTTTGAGCTTCAGTCAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations