ZFIN ID: ZDB-ALT-030903-2
Genomic Feature: w21
Synonyms: nof (1)
Affected Genomic Regions: gnat2
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Hurley Lab
Location: Chr 8: 25233008 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T at position 154 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Gln>Stop at position 52 (1)
FLANKING SEQUENCE (GENOMIC)
TGAACATCATAACATGCTTTTTAGAGAATCATTTTCACACTAATAATTGTTCTGTTTGTTTTAGAGCAGTCCTGCAGACCTGTGCAGATGGCGATCCAAAGTTGATTGACAGCATCTCCATGCCCCTGATGATGGCCAGAGCAGACTGCAGGATGTTGCCAAAAATAATAGATCGAAACTCCATTTGTTCTTCTTTTGTATAACCACCTTGATGGAGAATCCTTGGACAGGAACAAGAGGGGTTTTTATTAATGATTTGAAGATAAAGGACAGGCTCCTCATTCACTACCACCTAGTGATAACAGTTTAGGGTCTCAACTCTACTGTAGGTAAGCGCTGGTATTCCCCAAATGCACACTAAATGTTAAGGATTAATTCAGTTAGAATGCAAGAAACCTAAATCTCAATTCAAGAGCTTACACAGCTTGTCTACAAAGATACAAATTGTCATATCTGAGCATGTGTTTTGTATATCGCATGTGTTTCAACTCACTTCATCT
G/A
TTTTACAATGGTGCTCTTCCCTGATTCACCAGCACCTATAAAACAAAGGGGAAAAAACATGATGTAGAGCAAATAAAGGACAAACGAGTCCTCAAACGCTTTTAAACCAAACATCACACAAAGTTTTGGCACGATGAACTCCATCTGTAACTTTTAACTTCATTCGAAGGTCTTTGAACAAACCACATTGAGCTGAATCTTAGTCCCTTGGTTACATATTCCATTGTGACATTGATGTATCACTTCATACAGATAACATAATGCCTGAATTTTTCCTGAATTTAAACCATTTGTTTTCCTCTCTATGGATATTGATTTTAATAACAAGGTCAATGTTAAGCTGTAGATAACCTGTCAAGAAAAACTCATAGATTGCCATTGATGGGCAGGTCAGAGGAAGGCTTATGAGCCTGCTTATAAAGTGACCCAATTGGATTTGTGTTAGGGAAAGCTTCTCAGAAGATCACTGACACTTTGATTCGCCTTTGAGCTTCAGTCAG
(1)
OTHER w21 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous gnat2w21/w21 gnat2 ♀+/- ♂+/-
gnat2w21/w21 (AB) gnat2 Unknown
Heterozygous gnat2w21/+ (AB) gnat2 Unknown
Complex gnat2w21/+; mpv17a9/+ (AB) gnat2, mpv17

CITATIONS  (9)