header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-030617-2
Genomic Feature: em1
Synonyms:
Affected Genomic Regions: foxi1
Type: Indel (1)
Protocol: spontaneous 
Lab Of Origin: Fritz Lab
Location: Chr 12: 43664495 - 43664497 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 1 bp inserted / 3 bp deleted (1)
Transcript Consequence: Frameshift (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TCATCCTCATCCCGTGCAACTTTCTTAAAGCAGTCGTTTAATGACAGGTTGTGTCTTATAGAGTTCTGCCAGCCGGCTTTACTTTTCTTGTAAAAGGGAAAGTTGTCAGCCACGTACTGATAAATCTGACTGAGCGTCAGTTTCTTATCCTGCGCGTTCTGGATAGCCATCGCAATCAGCGCCGAGTACGAGTACGGCGGTCTGACCATCTTGAAAAGTTCTTGCTGACTTGATATGGAGAGCCAGCCCAAATCCGCGCTTCCAAAGCCGGTAGGAGGAGGGAGAAACTGCCGCTGGTTGGATCCAAATCCCGACTGGATATAAGAGCCTCCGTTTGGGCTTGAGAGGTACGGGGTGGAGGTGATGCCCGGGCTGTTCATCCACAGGTAAGGGTTGGTGCTCGGCGAGCTGTACTCGCCGAGCCCGTAGCTGGAGGGATGCGCAGGCGGCCTCTGGTGGTGGTGATGGTGGTGATGATGGTGCAGGTTCTGCTGGTACAT
GCT/C
GAAGTTGGAGTCGCAGTACACGGTCATGTCCAGGATGTCCTGCTGCTGAAGGGGACTGGTCTGCTGGCTCGACGGCTGCTGCCCAAACGCGTTCATAATCCGCTCTCCCTCCAGAAACATGGAGTTTCTCCGATCTGACCTGCTGAGTGTGCTCGTCTCTGAGGGGTTTCTCAAGGAGAGTGTCCGGGTGCGCTTCAGGGGAGGGTTATTTAACCTGTCCGGGGCGCATGCAGTGAATGGACTCATGTTGACTACTCCTCCCACTGTCACACTTCTTCTCAATTAACTTCATCCAATATGCATCAATCTGGCGTCGAGATCATTCACGTGATAAGCTTGCCGAACAAAGACTGTTTAAGCGCTAAAAAGGGTGGACACGTCTAAAAAATGGAAGATAGTTACACTGTAAAAAAAATAAAAAATCTTAAAATAAGTTTATACGAAGTCTCACTTTTTTTGTTAAACAAGCTGTTCTAAAGCGATAGTTCACCCTCAAGTGT
NOTES
Comment Citation
A two-base deletion produces a frameshift in codon 41 and results in a  ... Solomon et al., 2003
OTHER em1 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous foxi1em1/em1 foxi1 Unknown
foxi1em1/em1 foxi1 ♀+/- ♂+/-
Heterozygous foxi1em1/+ (AB) foxi1 Unknown
Complex tud70/tud70 ; foxi1em1/em1 (AB) dlx3b, dlx4b, foxi1

CITATIONS  (16)