ZFIN ID: ZDB-ALT-030502-2
Genomic Feature: y10
Synonyms:
Affected Genomic Regions: plcg1
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Weinstein Lab
Location: Chr 23: 2809317 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: in Acceptor Splice Site (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
ATCAGCGTTGTCAAATGTTAATGACGTAACCGCACTGATTCCGGAGCCTCTGAAAGTCCGCGAATGTTATGTGATACAGCACTGGAAAGCTGAGATTCTCTTCTTTATGCCAATATTTGAATTGTATGAATCGGATCAGCGGATCAAAAGTTATTAAACATTTAAGAGCAATACTTATTTTTAGCCGCGGGCGGCTGTCTCGGTCTTTAAGGGTTAAAACCGTTGATATGCAATTGTTCATGGTATGATAATCGTGCACGTTCAAATCGTGGTAGACCGTCATACCGGTATATTGTTACAACCCTAACCGTGATGCACCGAAATATCGAATTGAACCAAATCGATGGCATGATAATCGTAACCGAACCAAACCGTGAGACTAGTGTAGGTTCACAGCTCTAATAAAGATCATAATGTTCTTTCTTTCCTGTTCTGATTAAAACCTTTCTCGCGTGTAAAGACCACAGAAAAGCTCAAGTGTGTGTCCTGTGTCTCTTTCA
G/A
TTGATATCCGGGAGATTAAGGAGATCCGGACTGGACAGAAGTCTCGGGACTTTGAGCGATATGTGGAGGACGTCACGACCCGGCCGGACCAGGCCCACTGCTTCGTCATCCTCTACGGCACTGAGTTTCGCCTCAAATCCCTCAGTCTGGCAGGTAAATCAGTATCATATGAGCGACACACACGTGTGCTTTAAACGTCGCATGAACTGTGATGTTTGATGTAATTTCAAGTGAAACATGAAGACCAGTGTTTCCCAACCCTGTTCCTGACGGCACACCAACACTACACGTTTTCAACCTCTCCCTATTCAAACACACCTGAATCAACTCAACAGAACATTAGAAGAGGCATCAAACCTGAAATGAAAGGGTCGGATAAAGGAGACATCCAAAATATGTACTGTTGGTGTGCCTTCAGGAAGAGGGTTGGGAAACATTGATGGAGACAGGGTGGGACGTAAGGTAGATCCTCCCCTTTTAATATGAATGAATGGTTGAAT
(1)
Comment Citation
Mutation in splice acceptor site. ZFIN Staff
OTHER y10 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous plcg1y10/y10 plcg1 ♀+/- ♂+/-
plcg1y10/y10 plcg1 Unknown
Heterozygous plcg1y10/+ (AB) plcg1 Unknown
Complex plcg1y10/+; y1Tg/+ plcg1
plcg1y10/+; y1Tg/y1Tg plcg1
plcg1y10/y10; y1Tg plcg1
plcg1y10; y1Tg plcg1

CITATIONS  (15)